Journal: Cell

Article Title: Neuronal Inactivity Co-opts LTP Machinery to Drive Potassium Channel Splicing and Homeostatic Spike Widening

doi: 10.1016/j.cell.2020.05.013

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: This paper N/A Primers for RT-PCR and qPCR, see Table S1 This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: F: CCGGAATTCCGGC TATGTGGCAACCCTAC This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: R: CGCGGATCCGCGT CTCCTTTGACTTCCTCT This paper N/A Primers to measure E29 splicing in the splicing reporter: F: GGAGAAGTCTGCCGTTACTGCCC TGTG (DY-782 labeled) This paper N/A Primers to measure E29 splicing in the splicing reporter: R: CCGTCGTCCTTGAAGAAGATGGTGC This paper N/A Recombinant DNA mouse βCaMKK construct: Lentiviral CaMKKbeta Green et al., 2011b Addgene Plasmid #33322; RRID:Addgene_33322 rat βCaMKK 1–460 construct: pSG5-FLAG-CaMKKbeta rat 1–460 Green et al., 2011a Addgene Plasmid #33324; RRID:Addgene_33324 Human Nova-2 ORF Origene Cat# RC216200L1V, RC216200L2V pcDNA3-BK-GFP Li et al., 2014 N/A pCKII-GFP Li et al., 2016 N/A BK channel without E29 This paper N/A BK channel with E29 This paper N/A splice reporter pFlare5 vector Stoilov et al., 2008 N/A pGFP-C-shLenti βCaMKK shRNA constructs Origene Cat#TL711303 pGFP-C-shLenti Nova2 shRNA constructs Origene Cat#TL508674 pcDNA3.1/Puro-CAG-ASAP1 St-Pierre et al., 2014 Addgene Plasmid # 52519; RRID:Addgene_52519 AAV-CaMKIIa-GCaMP6s-P2A-nls-tdTomato Gift from Jonathan Ting (unpublished) Addgene Plasmid #51086; RRID:Addgene_51086 CaMKIV-GFP construct Gift from Haruhiko Bito N/A CA-CaMKIV construct Gifts from Tian-Ming Gao N/A CaMBP4 construct Gifts from Tian-Ming Gao N/A Software and Algorithms pClamp 9 Molecular Devices https://www.moleculardevices.com/ Prism GraphPad https://www.graphpad.com/ MATLAB Mathworks https://www.mathworks.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Mutagenesis, Immunoprecipitation, Isolation, Protein Extraction, Lysis, Labeling, Construct, Plasmid Preparation, shRNA, Software

Journal: Cell

Article Title: Neuronal Inactivity Co-opts LTP Machinery to Drive Potassium Channel Splicing and Homeostatic Spike Widening

doi: 10.1016/j.cell.2020.05.013

Figure Lengend Snippet: (A) Micrograph of a neuron expressing ASAP1. Scale bar, 10 μm.

Article Snippet: This paper N/A Primers for RT-PCR and qPCR, see Table S1 This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: F: CCGGAATTCCGGC TATGTGGCAACCCTAC This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: R: CGCGGATCCGCGT CTCCTTTGACTTCCTCT This paper N/A Primers to measure E29 splicing in the splicing reporter: F: GGAGAAGTCTGCCGTTACTGCCC TGTG (DY-782 labeled) This paper N/A Primers to measure E29 splicing in the splicing reporter: R: CCGTCGTCCTTGAAGAAGATGGTGC This paper N/A Recombinant DNA mouse βCaMKK construct: Lentiviral CaMKKbeta Green et al., 2011b Addgene Plasmid #33322; RRID:Addgene_33322 rat βCaMKK 1–460 construct: pSG5-FLAG-CaMKKbeta rat 1–460 Green et al., 2011a Addgene Plasmid #33324; RRID:Addgene_33324 Human Nova-2 ORF Origene Cat# RC216200L1V, RC216200L2V pcDNA3-BK-GFP Li et al., 2014 N/A pCKII-GFP Li et al., 2016 N/A BK channel without E29 This paper N/A BK channel with E29 This paper N/A splice reporter pFlare5 vector Stoilov et al., 2008 N/A pGFP-C-shLenti βCaMKK shRNA constructs Origene Cat#TL711303 pGFP-C-shLenti Nova2 shRNA constructs Origene Cat#TL508674 pcDNA3.1/Puro-CAG-ASAP1 St-Pierre et al., 2014 Addgene Plasmid # 52519; RRID:Addgene_52519 AAV-CaMKIIa-GCaMP6s-P2A-nls-tdTomato Gift from Jonathan Ting (unpublished) Addgene Plasmid #51086; RRID:Addgene_51086 CaMKIV-GFP construct Gift from Haruhiko Bito N/A CA-CaMKIV construct Gifts from Tian-Ming Gao N/A CaMBP4 construct Gifts from Tian-Ming Gao N/A Software and Algorithms pClamp 9 Molecular Devices https://www.moleculardevices.com/ Prism GraphPad https://www.graphpad.com/ MATLAB Mathworks https://www.mathworks.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE

Techniques: Expressing

Journal: Cell

Article Title: Neuronal Inactivity Co-opts LTP Machinery to Drive Potassium Channel Splicing and Homeostatic Spike Widening

doi: 10.1016/j.cell.2020.05.013

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: This paper N/A Primers for RT-PCR and qPCR, see Table S1 This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: F: CCGGAATTCCGGC TATGTGGCAACCCTAC This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: R: CGCGGATCCGCGT CTCCTTTGACTTCCTCT This paper N/A Primers to measure E29 splicing in the splicing reporter: F: GGAGAAGTCTGCCGTTACTGCCC TGTG (DY-782 labeled) This paper N/A Primers to measure E29 splicing in the splicing reporter: R: CCGTCGTCCTTGAAGAAGATGGTGC This paper N/A Recombinant DNA mouse βCaMKK construct: Lentiviral CaMKKbeta Green et al., 2011b Addgene Plasmid #33322; RRID:Addgene_33322 rat βCaMKK 1–460 construct: pSG5-FLAG-CaMKKbeta rat 1–460 Green et al., 2011a Addgene Plasmid #33324; RRID:Addgene_33324 Human Nova-2 ORF Origene Cat# RC216200L1V, RC216200L2V pcDNA3-BK-GFP Li et al., 2014 N/A pCKII-GFP Li et al., 2016 N/A BK channel without E29 This paper N/A BK channel with E29 This paper N/A splice reporter pFlare5 vector Stoilov et al., 2008 N/A pGFP-C-shLenti βCaMKK shRNA constructs Origene Cat#TL711303 pGFP-C-shLenti Nova2 shRNA constructs Origene Cat#TL508674 pcDNA3.1/Puro-CAG-ASAP1 St-Pierre et al., 2014 Addgene Plasmid # 52519; RRID:Addgene_52519 AAV-CaMKIIa-GCaMP6s-P2A-nls-tdTomato Gift from Jonathan Ting (unpublished) Addgene Plasmid #51086; RRID:Addgene_51086 CaMKIV-GFP construct Gift from Haruhiko Bito N/A CA-CaMKIV construct Gifts from Tian-Ming Gao N/A CaMBP4 construct Gifts from Tian-Ming Gao N/A Software and Algorithms pClamp 9 Molecular Devices https://www.moleculardevices.com/ Prism GraphPad https://www.graphpad.com/ MATLAB Mathworks https://www.mathworks.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Mutagenesis, Immunoprecipitation, Isolation, Protein Extraction, Lysis, Labeling, Construct, Plasmid Preparation, shRNA, Software

Journal: Cell

Article Title: Neuronal Inactivity Co-opts LTP Machinery to Drive Potassium Channel Splicing and Homeostatic Spike Widening

doi: 10.1016/j.cell.2020.05.013

Figure Lengend Snippet: (A) Micrograph of a neuron expressing ASAP1. Scale bar, 10 μm.

Article Snippet: This paper N/A Primers for RT-PCR and qPCR, see Table S1 This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: F: CCGGAATTCCGGC TATGTGGCAACCCTAC This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: R: CGCGGATCCGCGT CTCCTTTGACTTCCTCT This paper N/A Primers to measure E29 splicing in the splicing reporter: F: GGAGAAGTCTGCCGTTACTGCCC TGTG (DY-782 labeled) This paper N/A Primers to measure E29 splicing in the splicing reporter: R: CCGTCGTCCTTGAAGAAGATGGTGC This paper N/A Recombinant DNA mouse βCaMKK construct: Lentiviral CaMKKbeta Green et al., 2011b Addgene Plasmid #33322; RRID:Addgene_33322 rat βCaMKK 1–460 construct: pSG5-FLAG-CaMKKbeta rat 1–460 Green et al., 2011a Addgene Plasmid #33324; RRID:Addgene_33324 Human Nova-2 ORF Origene Cat# RC216200L1V, RC216200L2V pcDNA3-BK-GFP Li et al., 2014 N/A pCKII-GFP Li et al., 2016 N/A BK channel without E29 This paper N/A BK channel with E29 This paper N/A splice reporter pFlare5 vector Stoilov et al., 2008 N/A pGFP-C-shLenti βCaMKK shRNA constructs Origene Cat#TL711303 pGFP-C-shLenti Nova2 shRNA constructs Origene Cat#TL508674 pcDNA3.1/Puro-CAG-ASAP1 St-Pierre et al., 2014 Addgene Plasmid # 52519; RRID:Addgene_52519 AAV-CaMKIIa-GCaMP6s-P2A-nls-tdTomato Gift from Jonathan Ting (unpublished) Addgene Plasmid #51086; RRID:Addgene_51086 CaMKIV-GFP construct Gift from Haruhiko Bito N/A CA-CaMKIV construct Gifts from Tian-Ming Gao N/A CaMBP4 construct Gifts from Tian-Ming Gao N/A Software and Algorithms pClamp 9 Molecular Devices https://www.moleculardevices.com/ Prism GraphPad https://www.graphpad.com/ MATLAB Mathworks https://www.mathworks.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE

Techniques: Expressing

Journal: Cell

Article Title: Neuronal Inactivity Co-opts LTP Machinery to Drive Potassium Channel Splicing and Homeostatic Spike Widening

doi: 10.1016/j.cell.2020.05.013

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: This paper N/A Primers for RT-PCR and qPCR, see Table S1 This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: F: CCGGAATTCCGGC TATGTGGCAACCCTAC This paper N/A Primers to insert E29 and flanking introns to the splicing reporter: R: CGCGGATCCGCGT CTCCTTTGACTTCCTCT This paper N/A Primers to measure E29 splicing in the splicing reporter: F: GGAGAAGTCTGCCGTTACTGCCC TGTG (DY-782 labeled) This paper N/A Primers to measure E29 splicing in the splicing reporter: R: CCGTCGTCCTTGAAGAAGATGGTGC This paper N/A Recombinant DNA mouse βCaMKK construct: Lentiviral CaMKKbeta Green et al., 2011b Addgene Plasmid #33322; RRID:Addgene_33322 rat βCaMKK 1–460 construct: pSG5-FLAG-CaMKKbeta rat 1–460 Green et al., 2011a Addgene Plasmid #33324; RRID:Addgene_33324 Human Nova-2 ORF Origene Cat# RC216200L1V, RC216200L2V pcDNA3-BK-GFP Li et al., 2014 N/A pCKII-GFP Li et al., 2016 N/A BK channel without E29 This paper N/A BK channel with E29 This paper N/A splice reporter pFlare5 vector Stoilov et al., 2008 N/A pGFP-C-shLenti βCaMKK shRNA constructs Origene Cat#TL711303 pGFP-C-shLenti Nova2 shRNA constructs Origene Cat#TL508674 pcDNA3.1/Puro-CAG-ASAP1 St-Pierre et al., 2014 Addgene Plasmid # 52519; RRID:Addgene_52519 AAV-CaMKIIa-GCaMP6s-P2A-nls-tdTomato Gift from Jonathan Ting (unpublished) Addgene Plasmid #51086; RRID:Addgene_51086 CaMKIV-GFP construct Gift from Haruhiko Bito N/A CA-CaMKIV construct Gifts from Tian-Ming Gao N/A CaMBP4 construct Gifts from Tian-Ming Gao N/A Software and Algorithms pClamp 9 Molecular Devices https://www.moleculardevices.com/ Prism GraphPad https://www.graphpad.com/ MATLAB Mathworks https://www.mathworks.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Mutagenesis, Immunoprecipitation, Isolation, Protein Extraction, Lysis, Labeling, Construct, Plasmid Preparation, shRNA, Software